Place your order today at a 20% discount
Which of the following nuclear pre-mRNA nucleotide sequencespotentially contains an intron?After the intron has been spliced out, what will be the nucleotidesequence of mRNA molecule (without the intron)?NOTE: The consensus sequence for an intron is-5GU
.YNCURAY
..AG3(Y= Pyrimidine; R=Purine)
(a)5′–UGACCAUGGCGCUAACACUGCCAAUUGGCAAUACUGACCUGAUAGCAUCAGCCAA–3′(b)5′–UAGUCUCAUCUGUCCAUUGACUUCGAAACUGAAUCGUAACUCCUACGUCUAUGGA–3′(c)5′–UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC–3′(d)5′–UAGCAGUUCUGUCGCCUCGUGGUGCUGCUGGCCCUUCGUCGCUCGGGCUUAGCUA–3′(e)5′–UAGGUUCGCAUUGACGUACUUCUGAGACUACUAACUACUAACGCAUCGAGUCUCA-3
About ASAP Essays
We are a professional paper writing website. If you have searched a question and bumped into our website just know you are in the right place to get help in your coursework. We offer HIGH QUALITY & PLAGIARISM FREE Papers.
How It Works
To make an Order you only need to click on “Order Now” and we will direct you to our Order Page. Fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Are there Discounts?
All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.
Hire a tutor today CLICK HERE to make your first order